ID: 1060816521_1060816530

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1060816521 1060816530
Species Human (GRCh38) Human (GRCh38)
Location 9:126638174-126638196 9:126638192-126638214
Sequence CCCCTCTCTGCTGGTGTCCCTGG CCTGGCAGGTGGGTCCCGACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 33, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!