ID: 1060817986_1060817994

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1060817986 1060817994
Species Human (GRCh38) Human (GRCh38)
Location 9:126645390-126645412 9:126645418-126645440
Sequence CCAAATCCCTGCTGTACTTCAGG CCTCCAGCCAGGCAGGGAGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 8, 3: 75, 4: 629}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!