ID: 1060820117_1060820124

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1060820117 1060820124
Species Human (GRCh38) Human (GRCh38)
Location 9:126656837-126656859 9:126656859-126656881
Sequence CCGCATCCCCCAGTCCATGGCCA ATCAAAAATGTCTCCAGACATGG
Strand - +
Off-target summary No data {0: 8, 1: 36, 2: 75, 3: 124, 4: 395}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!