ID: 1060826523_1060826532

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1060826523 1060826532
Species Human (GRCh38) Human (GRCh38)
Location 9:126691042-126691064 9:126691067-126691089
Sequence CCGTGAGCCCCGACGAGTCCGAC CGGTGAGGCCTGGCCTGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 34} {0: 1, 1: 0, 2: 2, 3: 36, 4: 296}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!