ID: 1060862042_1060862051

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1060862042 1060862051
Species Human (GRCh38) Human (GRCh38)
Location 9:126962452-126962474 9:126962482-126962504
Sequence CCACCATTCTTAGCACTCCTAAG GCCATGCCAGGCGTGAGATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 153} {0: 1, 1: 0, 2: 0, 3: 5, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!