ID: 1060874274_1060874278

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1060874274 1060874278
Species Human (GRCh38) Human (GRCh38)
Location 9:127069055-127069077 9:127069090-127069112
Sequence CCTGCCTCCTTCTTCATATGCAC TAAAATCCTTAGTTCTGTCCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 30, 4: 323} {0: 1, 1: 0, 2: 0, 3: 27, 4: 231}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!