ID: 1060876694_1060876698

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1060876694 1060876698
Species Human (GRCh38) Human (GRCh38)
Location 9:127089070-127089092 9:127089100-127089122
Sequence CCCCGTTGAGGTTGGAGTGGGCA TATACCACCAGCCTCCCTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 119} {0: 1, 1: 1, 2: 0, 3: 12, 4: 112}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!