ID: 1060876694_1060876702

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1060876694 1060876702
Species Human (GRCh38) Human (GRCh38)
Location 9:127089070-127089092 9:127089107-127089129
Sequence CCCCGTTGAGGTTGGAGTGGGCA CCAGCCTCCCTTCTGGTAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 119} {0: 1, 1: 0, 2: 0, 3: 20, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!