ID: 1060878457_1060878467

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1060878457 1060878467
Species Human (GRCh38) Human (GRCh38)
Location 9:127100581-127100603 9:127100610-127100632
Sequence CCAGTTGTACCCAAGGCTTCCTG GGAGGTCTCTGATGTAGAGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 120, 4: 1812}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!