ID: 1060916376_1060916385

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1060916376 1060916385
Species Human (GRCh38) Human (GRCh38)
Location 9:127393890-127393912 9:127393943-127393965
Sequence CCAGAGAACAGCTACTCCTTGTG CTTTGGAAGGCCAAGGTGGAAGG
Strand - +
Off-target summary No data {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!