ID: 1060920201_1060920213

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1060920201 1060920213
Species Human (GRCh38) Human (GRCh38)
Location 9:127415042-127415064 9:127415080-127415102
Sequence CCTCCTCACACCCGCTCTGGCTT CCAAGGATGGAGTGAAATGCAGG
Strand - +
Off-target summary No data {0: 7, 1: 47, 2: 28, 3: 60, 4: 1091}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!