ID: 1060920207_1060920213 |
View in Genome Browser |
Spacer: 5 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1060920207 | 1060920213 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 9:127415052-127415074 | 9:127415080-127415102 |
Sequence | CCCGCTCTGGCTTACAGGGGGAA | CCAAGGATGGAGTGAAATGCAGG |
Strand | - | + |
Off-target summary | No data | {0: 7, 1: 47, 2: 28, 3: 60, 4: 1091} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |