ID: 1060933116_1060933126

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1060933116 1060933126
Species Human (GRCh38) Human (GRCh38)
Location 9:127501169-127501191 9:127501192-127501214
Sequence CCTGCCCTGCCTGTGGCCACCCT CCTCAAATTCTGCAGGTACAGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 10, 3: 97, 4: 774} {0: 1, 1: 0, 2: 3, 3: 14, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!