ID: 1060936988_1060936995

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1060936988 1060936995
Species Human (GRCh38) Human (GRCh38)
Location 9:127521712-127521734 9:127521738-127521760
Sequence CCACCCGGCAGGACACCTTCCTG CAGGACACCCCTTCATTCCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 18, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!