ID: 1060969557_1060969576

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1060969557 1060969576
Species Human (GRCh38) Human (GRCh38)
Location 9:127730443-127730465 9:127730472-127730494
Sequence CCCCATCTCACAGCCCCACCCCT CTGGGTCGCTGGGGGCTGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 102, 4: 823} {0: 1, 1: 0, 2: 1, 3: 98, 4: 746}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!