|
Left Crispr |
Right Crispr |
Crispr ID |
1060969566 |
1060969576 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
9:127730458-127730480
|
9:127730472-127730494
|
Sequence |
CCACCCCTCAGGGTCTGGGTCGC |
CTGGGTCGCTGGGGGCTGGGCGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 0, 2: 0, 3: 15, 4: 163} |
{0: 1, 1: 0, 2: 1, 3: 98, 4: 746} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|