ID: 1060971307_1060971320

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1060971307 1060971320
Species Human (GRCh38) Human (GRCh38)
Location 9:127739766-127739788 9:127739793-127739815
Sequence CCTCCACGCCGTGCTCCGTGCTG AGGGCTCAGGGCCCTCTGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 155} {0: 1, 1: 0, 2: 4, 3: 28, 4: 289}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!