ID: 1060980405_1060980423

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1060980405 1060980423
Species Human (GRCh38) Human (GRCh38)
Location 9:127788477-127788499 9:127788530-127788552
Sequence CCTGGGGCATTGAGCCTCAGGAG GCTCTTCTTCCCAGGGGAGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 162} {0: 1, 1: 0, 2: 2, 3: 48, 4: 589}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!