ID: 1060980621_1060980626

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1060980621 1060980626
Species Human (GRCh38) Human (GRCh38)
Location 9:127789503-127789525 9:127789523-127789545
Sequence CCGCCACCACCAACCAGACGGAG GAGTTTGAGCGCGTCTTCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 279} {0: 1, 1: 0, 2: 0, 3: 4, 4: 43}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!