ID: 1060983661_1060983668

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1060983661 1060983668
Species Human (GRCh38) Human (GRCh38)
Location 9:127807790-127807812 9:127807805-127807827
Sequence CCAGACTATTTCCCCATTGAAAC ATTGAAACGTGAGGGATGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 159} {0: 1, 1: 0, 2: 1, 3: 5, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!