ID: 1061007483_1061007490

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1061007483 1061007490
Species Human (GRCh38) Human (GRCh38)
Location 9:127936391-127936413 9:127936430-127936452
Sequence CCCAGAGGTTACTGACTGGCAGC GAAAACCCCACGGGTGAGTTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 121} {0: 1, 1: 0, 2: 0, 3: 4, 4: 78}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!