ID: 1061010135_1061010148

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1061010135 1061010148
Species Human (GRCh38) Human (GRCh38)
Location 9:127949876-127949898 9:127949916-127949938
Sequence CCACTGGAAACCTGCCCCCGGGG TTTCACTGATAATCCACTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 152} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!