ID: 1061029005_1061029010

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1061029005 1061029010
Species Human (GRCh38) Human (GRCh38)
Location 9:128068423-128068445 9:128068438-128068460
Sequence CCTGCGGCGGCGCTATCTGCGGG TCTGCGGGGGCCCGGACCACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 50} {0: 1, 1: 0, 2: 0, 3: 9, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!