ID: 1061038693_1061038704

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1061038693 1061038704
Species Human (GRCh38) Human (GRCh38)
Location 9:128127598-128127620 9:128127620-128127642
Sequence CCCCGCGAAGCCAGCCCGGCTCT TGCGTGGGTAGCAGCGGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 116} {0: 1, 1: 0, 2: 1, 3: 38, 4: 1679}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!