ID: 1061050337_1061050343

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1061050337 1061050343
Species Human (GRCh38) Human (GRCh38)
Location 9:128191441-128191463 9:128191461-128191483
Sequence CCGCGCGCCCTCAACGCTCAAGT AGTCGCCCCCACGGATGGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 577} {0: 1, 1: 0, 2: 0, 3: 3, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!