ID: 1061058717_1061058727

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1061058717 1061058727
Species Human (GRCh38) Human (GRCh38)
Location 9:128239708-128239730 9:128239750-128239772
Sequence CCTCCCCTCCCTCCCATTAGTGC ATGAACAAGAAGAAGACTTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 56, 4: 455} {0: 1, 1: 0, 2: 5, 3: 34, 4: 411}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!