|
Left Crispr |
Right Crispr |
| Crispr ID |
1061062455 |
1061062459 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
9:128257498-128257520
|
9:128257511-128257533
|
| Sequence |
CCAGCTCCTGCAGCTCCAGCAGC |
CTCCAGCAGCTTCACCTGGAGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 12, 2: 41, 3: 190, 4: 1292} |
{0: 21, 1: 9, 2: 2, 3: 36, 4: 407} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|