ID: 1061062545_1061062559

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1061062545 1061062559
Species Human (GRCh38) Human (GRCh38)
Location 9:128257942-128257964 9:128257995-128258017
Sequence CCACCCTTCTTGACCCATGCCAG GGCCCCCTGCAGGGCCCGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 22, 4: 221} {0: 6, 1: 4, 2: 4, 3: 33, 4: 274}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!