ID: 1061064238_1061064244

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1061064238 1061064244
Species Human (GRCh38) Human (GRCh38)
Location 9:128267450-128267472 9:128267469-128267491
Sequence CCTCTTACCTCCAGATCCTTCAG TCAGGTTAGCAGACGATGCAGGG
Strand - +
Off-target summary {0: 12, 1: 33, 2: 4, 3: 24, 4: 273} {0: 1, 1: 1, 2: 3, 3: 30, 4: 64}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!