ID: 1061067150_1061067157

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1061067150 1061067157
Species Human (GRCh38) Human (GRCh38)
Location 9:128285668-128285690 9:128285703-128285725
Sequence CCCTCAGCTGTGGCCAGGGTCAC TGGCTGGCAACCCCACCCTAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!