ID: 1061067153_1061067166

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1061067153 1061067166
Species Human (GRCh38) Human (GRCh38)
Location 9:128285681-128285703 9:128285731-128285753
Sequence CCAGGGTCACATGGTACCACTGT GGGCACATTTGCCAGGAGTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 15, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!