ID: 1061071173_1061071179

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1061071173 1061071179
Species Human (GRCh38) Human (GRCh38)
Location 9:128311578-128311600 9:128311595-128311617
Sequence CCAGCTTCTCTCTGGTCACGTGG ACGTGGTCTGGAAAAGGCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 159} {0: 1, 1: 0, 2: 0, 3: 12, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!