ID: 1061083853_1061083863

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1061083853 1061083863
Species Human (GRCh38) Human (GRCh38)
Location 9:128387869-128387891 9:128387914-128387936
Sequence CCAGAGTTGTTCATCCAGGGAGA CCTTCCCTGAAGCAGGTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 115} {0: 1, 1: 0, 2: 4, 3: 30, 4: 400}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!