ID: 1061084874_1061084880

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1061084874 1061084880
Species Human (GRCh38) Human (GRCh38)
Location 9:128392988-128393010 9:128393006-128393028
Sequence CCTGGGGAACCCCGACTCCCCTC CCCTCTCCCTGCCCCCAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 200} {0: 1, 1: 3, 2: 15, 3: 182, 4: 1208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!