ID: 1061088297_1061088309

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1061088297 1061088309
Species Human (GRCh38) Human (GRCh38)
Location 9:128412005-128412027 9:128412044-128412066
Sequence CCCTTGGCCACAAAGCAGGACAG CAACTCAGGAGACGTGAAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 274} {0: 1, 1: 0, 2: 0, 3: 21, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!