ID: 1061135952_1061135963

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1061135952 1061135963
Species Human (GRCh38) Human (GRCh38)
Location 9:128733617-128733639 9:128733652-128733674
Sequence CCTGGTGTCGGGGGTGTGAAGGC GGGGGCAGTGCTAGAAATGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 139} {0: 1, 1: 0, 2: 0, 3: 27, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!