ID: 1061141940_1061141946

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1061141940 1061141946
Species Human (GRCh38) Human (GRCh38)
Location 9:128772373-128772395 9:128772386-128772408
Sequence CCAGGCAACCGAGCTTCCAAATG CTTCCAAATGGGAAATTGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 98} {0: 1, 1: 0, 2: 0, 3: 30, 4: 236}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!