ID: 1061144153_1061144160

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1061144153 1061144160
Species Human (GRCh38) Human (GRCh38)
Location 9:128787398-128787420 9:128787425-128787447
Sequence CCCGGCTGGGCCACTCCTGGCCA GCCCCTTCTGCCCCTCAGAAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 61, 4: 446} {0: 1, 1: 0, 2: 0, 3: 18, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!