ID: 1061162476_1061162491

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1061162476 1061162491
Species Human (GRCh38) Human (GRCh38)
Location 9:128903147-128903169 9:128903199-128903221
Sequence CCCCATCTCTGGGATGGGGCTAT GACCCTAGGAGGGCCTGCAGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!