ID: 1061178381_1061178391

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1061178381 1061178391
Species Human (GRCh38) Human (GRCh38)
Location 9:129010511-129010533 9:129010550-129010572
Sequence CCCACAGAGGGGAAACTGAGGCC TAACCCCTCCCCAGTGGGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 18, 3: 62, 4: 409} {0: 1, 1: 0, 2: 0, 3: 19, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!