ID: 1061184146_1061184153

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1061184146 1061184153
Species Human (GRCh38) Human (GRCh38)
Location 9:129042331-129042353 9:129042354-129042376
Sequence CCAGGCCTGCGGAAAGTCCTCTT TGCCACGGCCCTGGGGACTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 119} {0: 1, 1: 0, 2: 0, 3: 31, 4: 382}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!