ID: 1061194112_1061194124

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1061194112 1061194124
Species Human (GRCh38) Human (GRCh38)
Location 9:129098218-129098240 9:129098271-129098293
Sequence CCTCCTCCATGGGTGGGCCACAG CCATCTGGATGAAGGCATCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 237} {0: 1, 1: 0, 2: 3, 3: 19, 4: 154}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!