ID: 1061208247_1061208258

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1061208247 1061208258
Species Human (GRCh38) Human (GRCh38)
Location 9:129176703-129176725 9:129176724-129176746
Sequence CCGCCTGCCCCCGCTCGCCCCCA CAGCTCAGCCCCGAGTGGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 128, 4: 1021} {0: 1, 1: 0, 2: 2, 3: 31, 4: 274}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!