ID: 1061212700_1061212704

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1061212700 1061212704
Species Human (GRCh38) Human (GRCh38)
Location 9:129203000-129203022 9:129203027-129203049
Sequence CCGCTGGCGCGGACGTTCGCGGA CCCGGCGCCCGCGCGGCTCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 10} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!