ID: 1061306647_1061306662

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1061306647 1061306662
Species Human (GRCh38) Human (GRCh38)
Location 9:129736376-129736398 9:129736420-129736442
Sequence CCAGGCAGCCGCTCCCCAGCAGG TCCATCAGGGCGCTGAGCCTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!