ID: 1061395413_1061395422

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1061395413 1061395422
Species Human (GRCh38) Human (GRCh38)
Location 9:130341115-130341137 9:130341136-130341158
Sequence CCCTCAGGTGCAGCCAGGCCCTC TCGGGTTCTGAAGGTGCTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 25, 4: 266} {0: 1, 1: 0, 2: 0, 3: 10, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!