ID: 1061396937_1061396948

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1061396937 1061396948
Species Human (GRCh38) Human (GRCh38)
Location 9:130348547-130348569 9:130348573-130348595
Sequence CCCCCCAGCATCCGGGAGGACGG CAAGGCCAACGTGTCGGGTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 154} {0: 1, 1: 0, 2: 0, 3: 2, 4: 37}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!