ID: 1061424301_1061424314

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1061424301 1061424314
Species Human (GRCh38) Human (GRCh38)
Location 9:130489578-130489600 9:130489610-130489632
Sequence CCCACTGCCATCCTCATGTGAGA GTGCAGGCCAAAGGGGGTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 191} {0: 1, 1: 0, 2: 0, 3: 13, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!