ID: 1061450901_1061450906

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1061450901 1061450906
Species Human (GRCh38) Human (GRCh38)
Location 9:130666535-130666557 9:130666551-130666573
Sequence CCCGGCGGGGAAGGAAGGGCCGG GGGCCGGGCCTCGGCTGCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 43, 4: 348} {0: 1, 1: 0, 2: 3, 3: 33, 4: 287}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!