ID: 1061450901_1061450907

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1061450901 1061450907
Species Human (GRCh38) Human (GRCh38)
Location 9:130666535-130666557 9:130666552-130666574
Sequence CCCGGCGGGGAAGGAAGGGCCGG GGCCGGGCCTCGGCTGCCTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 43, 4: 348} {0: 1, 1: 1, 2: 1, 3: 30, 4: 313}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!